news

News 04.06.20 : Today’s Articles of Interest from Around the Internets

by

News 04.06.20 : Today’s Articles of Interest from Around the Internets
@therollinsonlondon
News 04.06.20 : Today’s Articles of Interest from Around the Internets
@nicoleballardini
News 04.06.20 : Today’s Articles of Interest from Around the Internets
@_zoemarch

A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA

Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — acg and u — and translate them into coronavirus proteins.

Read the rest of this article at: The New York Times

News 04.06.20 : Today’s Articles of Interest from Around the Internets

News 04.06.20 : Today’s Articles of Interest from Around the Internets

In 1981, a young man visited Cedars-Sinai hospital, in Los Angeles, with shortness of breath and with curious purplish lesions on his skin. After reviewing biopsies and scans, a twenty-eight-year-old medical resident named David Ho found an odd fungal infection in the patient’s lungs and a rare cancer, Kaposi’s sarcoma. These conditions were both associated with immune deficiency, though nothing in the patient’s history explained why he would be in such a state. He was given antibiotics and discharged; not long after, he died. Over a few months, Ho and his colleagues saw five men with similar symptoms. They wrote up the cases and sent them to the Centers for Disease Control—the first report of what became known as AIDS.

Ho continued to explore the disease. “Some people were very concerned that I was so intrigued by those few cases at the very beginning of my career,” he told me. “ ‘Why would you want to devote your career to an esoteric disease?’ ” Particularly one that seemed mainly to afflict what was considered a fringe population—gay men. But Ho, who had emigrated from Taiwan when he was twelve, speaking no English, had an underdog mentality and would not be dissuaded.

He made several discoveries throughout the nineteen-eighties about H.I.V., the virus that causes aids, and in 1990, at the age of thirty-seven, he moved to New York to become the director of the Aaron Diamond aids Research Center. A year later, he received a call asking him to fly back to L.A. to test a very important patient. There, he confirmed that Earvin (Magic) Johnson was H.I.V.-positive. The following week, Johnson disclosed his condition and announced that he was retiring from the N.B.A. Ho has cared for him ever since. Johnson later said that he’d never thought aids would kill him, because Ho had assured him that better medicines were in the pipeline. In 1994, Ho found that a certain class of drugs could dramatically reduce the viral load in aids patients. But, within each infected individual, the virus evolved quickly, evading treatments. One drug was not enough. His team devised the idea of an aids “cocktail”—a combination of three or four drugs that, acting in concert, could corner the virus. In 1996, Time named Ho its Man of the Year.

Read the rest of this article at: The New Yorker

Tuscany Tote in Midnight

Shop the Tuscany Tote in Midnight
at Belgrave Crescent & shop.thisisglamorous.com

So you’re really, really into food. You also have no idea how to cook it. I get it, I’ve been there. There are more of us than you might think: Younger Americans grew up in a system awash in convenience foods, while our parents were working longer and harder and had less and less time to cook. Then, when we became adults, time and money were scarcer still, and restaurants became the places we gathered with our friends.

When I taught myself to cook at home, I immediately discovered most recipes aren’t written for anxious beginners. Instead, they assume the cook is already competent and looking to level up or add another dish to their repertoire. The rewards and demands of social media virality have only supercharged recipes’ emphasis on novelty and visual beauty. As someone who now knows how to cook, I love reading about a hack for cooking short ribs or a surprising use for my rice cooker. But back when I barely knew how to boil water, recipes telling me which tweak or technique yielded ideal results made turning on the oven feel high stakes. All that emphasis on aspiration and perfection made it way too hard to get started.

I’ve been cooking at home for a decade now, and to be honest, I’m still pretty basic. I sometimes feel embarrassed that I haven’t moved on from roasting chickens and simmering beans, but right now, basic-ness isn’t a crutch — it’s useful. With that spirit in mind, I’ve put together a series of recipes, and notes on recipes, that get really, really basic. Think of it as a roadmap to kitchen competence, a few pages from the grammar manual of home cooking from the dialect I speak.

Read the rest of this article at: Eater

News 04.06.20 : Today’s Articles of Interest from Around the Internets

News 04.06.20 : Today’s Articles of Interest from Around the Internets

Dusk was descending through the rainforest when the Cameroonians and Pakistanis stumbled into the campsite. They were in their 20s and 30s and loaded down with knapsacks, tents, and shoulder bags. Mud covered their rubber boots. They looked dazed, trying to make out who was occupying the small clearing that had just opened up in front of them.

The site was not much to speak of, a patch of dirt dotted with stumps and discarded pieces of tent fabric. Several men lay in hammocks that hung between slender trees. The one extravagance was a kitchen, shaded by a tarp and consisting of a rough wooden table, a couple of open fire pits, and some blackened pots that rested on rocks.

The four Pakistani men, the first to arrive, were breathing hard. Most of the Cameroonians — there were 18 in all — made straight for a nearby river, their plastic passport holders dangling in the water as they doused their faces. Some stripped off their clothes and washed themselves. A woman named Sandra stood motionless, in obvious pain. Twenty-three years old, she was one of the youngest in the group. Tight ringlets, their ends a rusty blond from old highlights, framed her face. Wrenching off her knapsack, she sat down on a log and hugged her knees. She was worried about her friend Benita, who had twisted her knee the day before and had been struggling. When Benita limped in, leaning heavily on a thick branch, Sandra looked up. “How many more days?” she asked to no one in particular.

Sandra and her group had set out two days earlier from northwestern Colombia and had walked at least 15 miles on steep, unforgiving trails across a swath of land known as the Darién Gap. Straddling the border of Panama and Colombia, the Gap is approximately 10,000 square miles of dense, mountainous rainforest and marshland. There are no roads. The only way around it is by sea. It has long been considered one of the most dangerous regions in the world: a corridor for drug trafficking and home to jaguars and venomous snakes. This has not stopped thousands of migrants from Africa, South Asia, the Middle East, and the Caribbean from traversing it in the hope that they will reach the United States.

The Pakistanis and Cameroonians were brought to the camp by a smuggler they’d hired in Colombia. Smugglers use the camp as a way station, a place to hand off migrants to other coyotes who will guide them deeper into Panama. This was all part of an elaborate, clandestine system that most migrants barely understand. Many have no idea how long it takes to cross the Darién.

The Cameroonians had gone through almost all of their food, and they started to crowd around the kitchen. Rice and chicken in the middle of a rainforest was an unexpected luxury. When some grabbed plates, a smuggler slapped their hands. The cook held up five fingers: “Five dollar!” A Cameroonian man pulled out a $100 bill and paid for Sandra’s and Benita’s plates. Everyone called him “Pastor.” “I like to talk about God a lot,” he explained, laughing. Before he left Cameroon, he said that God had revealed to him that the journey would not be easy and that he would need to shepherd his people. They would encounter armed robbers, and the armed robbers would attack many groups but not Pastor’s. They would see many dead bodies, but he should not be afraid. Pastor was compact and muscular and over the previous two days had become one of the group’s leaders. Pastor said everyone now needed to eat and rest.

Sandra wanted to know: “When can we really rest?” No one had an answer. She asked for pills, any kind of pills, not for something in particular but because she hurt all over. Benita, who was sitting beside her, could feel her leg stiffening. One of the Pakistanis offered camphor ointment that a Cameroonian started rubbing onto her leg. As he reached her knee, Benita cried out and slid down from the log, her companions pinning her as she writhed in pain. Hours later, when everyone was asleep, one tent glowed orange. Pastor’s silhouette appeared, kneeling in prayer.

Read the rest of this article at: The California Sunday Magazine

News 04.06.20 : Today’s Articles of Interest from Around the Internets

Withers has been out of the spotlight for so many years that some people think he passed away. “Sometimes I wake up and I wonder myself,” he says with a hearty chuckle. “A very famous minister actually called me to find out whether I was dead or not. I said to him, ‘Let me check.’ ”

Others don’t believe he is who he says: “One Sunday morning I was at Roscoe’s Chicken and Waffles. These church ladies were sitting in the booth next to mine. They were talking about this Bill Withers song they sang in church that morning. I got up on my elbow, leaned into their booth and said, ‘Ladies, it’s odd you should mention that because I’m Bill Withers.’ This lady said, ‘You ain’t no Bill Withers. You’re too light-skinned to be Bill Withers!’ ”

His career lasted eight years by his own count; in that time, he wrote and recorded some of the most loved, most covered songs of all time, particularly “Lean on Me” and “Ain’t No Sunshine” — tunes that feature dead-simple, soulful instrumentation and pure melodies that haven’t aged a second. “He’s the last African-American Everyman,” says Questlove. “Jordan’s vertical jump has to be higher than everyone. Michael Jackson has to defy gravity. On the other side of the coin, we’re often viewed as primitive animals. We rarely land in the middle. Bill Withers is the closest thing black people have to a Bruce Springsteen.”

Withers was stunned when he learned he had been inducted into the Rock and Roll Hall of Fame this year. “I see it as an award of attrition,” he says. “What few songs I wrote during my brief career, there ain’t a genre that somebody didn’t record them in. I’m not a virtuoso, but I was able to write songs that people could identify with. I don’t think I’ve done bad for a guy from Slab Fork, West Virginia.”

Withers’ hometown is in a poor rural area in one of the poorest states in the Union. His father, who worked in the coal mines, died when Bill was 13. “We lived right on the border of the black and white neighborhood,” he says. “I heard guys playing country music, and in church I heard gospel. There was music everywhere.”

The youngest of six children, Withers was born with a stutter and had a hard time fitting in. “When you stutter, people have a tendency to disregard you,” he says. That was compounded by the unvarnished Jim Crow racism that was a way of life in his youth. “One of the first things I learned, when I was around four, was that if you make a mistake and go into a white women’s bathroom, they’re going to kill your father.” He was a teenager when Emmett Till, a 14-year-old from Chicago who allegedly whistled at a white woman while visiting relatives in Mississippi, was beaten to death by two men who were cleared of all charges by an all-white jury. “[Till] was right around my age,” says Withers. “I thought, ‘Didn’t he know better?’ ”

Desperate to get out of Slab Fork, he enlisted in the Navy right after graduating from high school in 1956. Harry Truman had desegregated the armed forces eight years earlier, but Withers quickly discovered that didn’t mean much at his first naval base, in Pensacola, Florida. “My first goal was, I didn’t want to be a cook or a steward,” he says. “So I went to aircraft-mechanic school. I still had to prove to people that thought I was genetically inferior that I wasn’t too stupid to drain the oil out of an airplane.”

By the time he was transferred to California in the mid-1960s, he realized he’d never have the courage to quit the Navy if he couldn’t rid himself of his stutter. “I couldn’t get out a word,” he says. “I realized it wasn’t physical. I figured out that my stutter — and this isn’t the case for everyone — was caused by fear of the perception of the listener. I had a much higher opinion of everyone else than I did of myself. I started doing things like imagining everybody naked — all kinds of tricks I used on myself.”

Against all conventional wisdom, it worked (though he still trips over the occasional word), and in 1965 he quit the Navy and became “the first black milkman in Santa Clara County, California.” He eventually took a job at an aircraft parts factory. As a Navy aircraft mechanic, he was ridiculously overqualified, but “it was all about survival.”

Read the rest of this article at: RollingStone

P.S. previous articles & more by P.F.M.

Follow us on Instagram @thisisglamorous